This allele from project TCPR1137 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCTCCGCGAGTTGTTGGCGG, AAAAGACGTCCAGCGGCGAG and GGGTCCACGAGGTGGTGTAG targeting a critical exon. This resulted in a 36-bp deletion Chr19:46003690 to 46003725 and 2,084-bp del Chr19:46003853 to 46005936 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count