This allele from project TCPR1076 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGTCCTCCAGTCCCGGGTG, GTTGAACGAGGACCACCGGA and CGAGTCCCCTGCTGTCTCGG. This resulted in a 869-bp del Chr9:60737072 to 60737940_insT (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count