This allele from project TCPR1080 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCCCGGTTCTTCATCCAATT targeting the 5' side and GACTGCACTCACGGCCATCT targeting the 3' side of a critical exon. This resulted in a 1485-bp del Chr5:137799545 to 137801029. (GRCm38). (J:265051, J:296124)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count