This allele from project TCPR1123 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TTAGCCCCAAGTGCTTAGTC, TGCGATTGCGAGTGAGCACG, GTCCAATACTTGGACGACTA. This resulted in a 415-bp del Chr18: 37442713 to 37443127 which corresponds to c.143_557del and is predicted to cause p.T48Mfs*7 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count