This allele from project TCPR1201 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACTGCGGTCGTCCTGAACTA and TTGCAATGCCCTCTCCTTCG targeting the 5' side and AATGGTCCCACATATTGTTC and TCGCTTTCAGCTTCTACGTG targeting the 3' side of a critical exon resulting in a 673-bp deletion Chr11: 5570832 to 5571504 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count