This allele from project TCPR1203 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAGCGGCTAGTCTGACCAT and AATCTGTGATGTCGGGTTCC targeting the 5' side and CACTCTTAGACGCTGGATCG targeting the 3' side of a critical exon. This resulted in a 137-bp del ChrX: 74353349 to 74353485 predicted to result in c.43_179del, p.(G16Wfs*41) (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count