This allele from project TCPR1071 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCCTGACAGTTACATT and ATGCAGTGTGATGAATACTG targeting the 5' side and CAGCATGAGAACCGTGGGAG targeting the 3' side of a critical exon. This resulted in a 1062-bp deletion Chr7:100389398 to 100390459 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count