This allele from project TCPR1074 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTGCTACCCGGGTCCCATC, ACGCCCTGGACTACGCGCTT, GCTGCACGTTATCCTCGATG. This resulted in a 193-bp del Chr1: 90811522 to 90811714 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count