This allele from project TCPR1152 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCAGTGGAGTCGGGCGCTCT targeting the 5' side and ATGGGCGTCTCGACCCGCAC targeting the 3' side of a critical exon resulting in a 79-bp deletion Chr8: 95633624 to 95633702 (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count