This allele from project TCPR1075 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AACTGGGTGAGGGCCTCATC and CTGGAAGGTTAAACTCCTGC targeting the 5' side and AGGCCACCCCCTGTGCCGAG and CCTCCAACATGGCGCTCAAG targeting the 3' side of a critical exon. This resulted in a 684-bp deletion Chr1:75438290 to 75438973 resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count