Single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) of the gene resulting in a 4 bp frameshift deletion. The deletion is predicted to result in NAIP proteins truncated before the NBD (a domain essential for NAIP). (J:233320)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count