This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCCTAGAGAGTTACCATG and GCTAAAACGTTAACATAGGA, which resulted in an 837 bp deletion beginning at Chromosome 3 position 152,186,292 bp and ending after 152,187,134 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000175378(exon 5) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 6 amino acids later. Also, after the deletion of 381 bp of sequence there is a 6 bp [GGTCTT] endogenous retention followed by an additional 405 deleted bp. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count