Insyn2a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGCTGCAGTCTGACAA and GATTTGGCTGGACGTCCATT, which resulted in a 1383 bp deletion beginning at Chromosome 7 position 134,917,508 bp and ending after 134,918,890 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000632020 (exon 2) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele by removing the start of translation. (J:188991)