This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACAAACATATAGAGAATTG and ATAAGTCTGGAGTTTATCAT, which resulted in an 861 bp bp deletion beginning at Chromosome 6 position 133,036,176 bp and ending after 133,037,036 bp (GRCm38/mm10). This mutation deletes 861 bp from ENSMUSE00000196281 (exon 1) and is predicted to cause a change of amino acid sequence after residue 22 back in frame for stop 3 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count