Cnep1r1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGTGGTATCAAGACTGAA and GGATTAACATTATTAGTAGC, which resulted in a 223 bp deletion beginning at Chromosome 8 position 88,125,028 bp and ending after 88,125,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001306508 (exon 3) and 149 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 15 amino acids later. (J:188991)