This allele was generated at The Jackson Laboratory by Microinjection Cas9 mRNA and 2 guide sequences AGGGGATATGAGGCAACACG and TGAAGCTAGAACCCCTATCT, which resulted in a 605 bp deletion beginning at Chromosome 6 position 35,186,016 bp and ending after 35,186,665 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000469332 (exon 3) and 478 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 15 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count