Krt40^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTTTCCTCAAGGCCTGACTA, TCCATAACTGTAGCTCCGTG, AGTGAAAGAAAGGCGTGGCC and AAGTTCAGATTCTCTTGGTT, which resulted in a 2013 bp deletion beginning at Chromosome 11 position 99,538,431 bp and ending after 99,540,443 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503157, ENSMUSE00001061939, ENSMUSE00000577306 (exons 4-6) and 1504 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 229 and early truncation 16 amino acids later. (J:188991)