This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGGCTGGAGAAATTCCG and TAGAAGCTTAACTATTGAAT, which resulted in a 1550 bp deletion beginning at Chromosome 10 position 122,448,382 bp and ending after 122,449,931 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000100823 (exon 1) and 259 bp of flanking intronic sequence including the start of translation and splice donor and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count