This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGACCACCCCATAAGAATT and GACTTGTCTTGCCATTAGTA, which resulted in a 2461 bp deletion beginning at Chromosome 3 position 105,815,236 bp and ending after 105,817,696 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001347726-ENSMUSE00001353780 (exons 1-4) and 1400 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to create a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count