Cyp4f39^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGAGTGGGGAGCAACTCA and GATAGAAGTTCACCAAACTG, which resulted in a 437 bp deletion beginning at Chromosome 17 position 32,470,647 bp and ending after 32,471,083 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000511656 (exon 2) and 292 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 13 amino acids later. (J:188991)