Arhgap4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTAGTCATGACCTTCAGCA, TGTCTGCCCGCCCTAAACCA, ATTTCAGATCTGAATCTTGG and TCAGAAGCCCCTGTGCACTT, which resulted in a 1177 bp deletion beginning at Chromosome X position 73,905,895 bp and ending after 73,907,071 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001242137, ENSMUSE00001255499, ENSMUSE00001218299 (exons 2-4) and 743 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 15 amino acids later. (J:188991)