Lrfn1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCCGGAGGAGAAGGGGCC and CAGATGACTCCCTAGTCTAC, which resulted in a 1398 bp deletion beginning at Chromosome 7 position 28,458,664 bp and ending after 28,460,061 bp (GRCm38/mm10). This mutation deletes 1398 bp of ENSMUSE00000365917 (exon 1) and is predicted to cause a change of amino acid sequence and early truncation after residue 4. (J:188991)