This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACTGCAGGAGGCCCCAAG and GGTGGTATACAATGGTGGGA, which resulted in a 3613 bp deletion beginning at Chromosome 4 position 155,840,716 bp and ending after 155,844,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503248 through ENSMUSE00000228201 (exons 2 through 10) and 1575 bp of flanking intronic sequence including the splice acceptors and donors. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count