This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAGCATGACGTTATTAAT and AGCCTCGAAGCAAACCTCTG, which resulted in a 1622 bp deletion beginning at Chromosome 5 position 97,455,345 bp and ending after 97,456,966 bp (GRCm38/mm10). This mutation deletes 1622 bp from ENSMUSE00000356565 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 7 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count