This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTGCCCAAAGGGTAGCAG and AGCTGTTGTGAAAGGACCAG, which resulted in a 282 bp deletion beginning at Chromosome 4 position 136,229,360 bp and ending after 136,229,641 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000497964(exon5) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 141 and early truncation 36 amino acids later. (J:188991)