This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTGGACTTCGAGCAACTCAG, TCCCTGTTCACACATCCACT, GACTTCGAGCAACTCAGAGG and CTAGGCAGAGGATGAACACC, which resulted in a 166 bp deletion beginning at Chromosome 9 position 71,548,688 bp and ending after 71,548,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216161 (exon 9) and 86 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 311 and early truncation 19 amino acids later. In addition, there is a single bp A insertion at the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count