Trpm3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGTGAAATCAGAAATGTA and GGGCGGGCACATATGAGTAG, which resulted in a 427 bp deletion beginning at Chromosome 19 position 22,711,598 bp and ending after 22,712,024 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000461933 (exon 4) and 213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 156 and early truncation 9 amino acids later. (J:188991)