A deletion was engineered in exon 4 using synthetic tracrRNA (trans-activating crRNA), crRNA (CRISPR RNA) (target sequence ACCTGAGCCTGAGAGCTCTG) and an oligonucleotide repair template using CRISPR/Cas9 technology. This mutation is associated with human Rett syndrome. The mRNA levels from this allele are 45% of wild-type and protein expression 10%. (J:265095)
Basic Information
(C57BL/6J x CBA/CaOlaHsd)F2
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count