This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGGCCCGTCAGCCCTCCACA, ACAGTCTGTCCTAGTCAGCG, TGACATGTCCTGGATTCAGT and AGGGACTTGGACTCGAAGGG, which resulted in a 608 bp deletion beginning at Chromosome 9 position 110,870,349 bp and ending after 110,870,956 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000388720 (exon 4) and 490 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 67 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count