This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGACTTATATAACCTCACAC and GCACTTGCAATAACCAGCAG, which resulted in a 392 bp deletion beginning at Chromosome 5 position 41,703,352 bp and ending after 41,703,743 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000964047 (exon 2) and 295 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 2 amino acids later. (J:188991)