Pfdn1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCACGGGGCTCTCTTAGGAG, GTAGCCAGAGAGTAATAAAA, TCTCACTCTCTGTCGGGGCA and GGTCATGCGGTCTATGGATA, which resulted in a 493 bp deletion beginning at Chromosome 18 position 36,451,035 bp and ending after 36,451,527 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000141136 (exon 2) and 326 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 24 amino acids later. (J:188991)