Piezo2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGGGGCTCATTTCAACCTAA, CCTTGACGTTGGAAAGCCAA, TTACTACACACTAGGTTATG and GCAAACGTCTCCACTCTCCT, which resulted in a 443 bp deletion beginning at Chromosome 18 position 63,030,248 bp and ending after 63,030,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304790 (exon 42) and 190 bp of flanking intronic sequence including the splice acceptor and donor. At the deletion site there is a 126 bp insertion (AGAATGGGGACGAGGAGTGTTAGGATATTAATAAAGAACACTATTAGGGAGAGGATTTGAACCTCTGGGAACAAGGTTTTAAGTCTTACGCAATTTCCTGGCTCTGCCACCCTAATAACCTTCTCT) that is from the mouse mitochondrial genome (ChrM 2666-2791). This 126 bp segment contains the coding sequence for mt-Tl1 (tRNA leucine 1). The exon deletion is predicted to cause a change of amino acid sequence after residue 2106 and early truncation 15 amino acids later. (J:188991)