This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AACTGGCCCTGGCCTGAAGT, GTTCACCCAGAGAATGCCGT, CAGGTTTGGGGAGCTGACGT and AGAGATTCTACCTCATTCCC, which resulted in a 536 bp deletion beginning at Chromosome 16 position 20,608,702 bp and ending after 20,609,237 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314958, ENSMUSE00001226643, and ENSMUSE00001255837 (exons 2,3,4) and 127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 5 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count