1600014C10Rik^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCCTCATTCCCCAACAA, GCACTGCCTACACAGGACTG, TCTTAGTTGGCACAGTTCTG and GACCGGGGCTCTCTGTGTGG, which resulted in a 3,339 bp deletion beginning at Chromosome 7 position 38,194,467 bp and ending after 38,197,805 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635238 and ENSMUSE00000446563 (exons 3,4) and 480 bp of flanking intronic and 3 downstream sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 43 amino acids later. (J:188991)