This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGGCCCTGTGCCCAGCCATA, GGCTGAATTATGCTGATAGA, GTACCCTTTCGGGGCATTTC and TAAAAGTTTTGTTAGTTCTA, which resulted in a 519 bp deletion beginning at Chromosome 16 position 11,162,346 bp and ending after 11,162,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000563629 (exon 3) and 479 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 6 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count