Zc3h13^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CCAATAATAATAACACCATA, GTCAGGTAGGGGCTCTTTAA, AGAGAGTAGTTCCTGGAATG and CACCTGGGGCTGTGTCAGGT, which resulted in a 563 bp deletion beginning at Chromosome 14 position 75,291,999 bp and ending after 75,292,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000122846 (exon 3) and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 7 amino acids later. (J:188991)