Xylt1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CATTTGAACAGAACCCCAGA, CCGAGATCATATCTGCTAAA, TGGTCACTGTGAGCGTGGAG and TCAGGGTTTGAGGTGCAGTG, which resulted in a 991 bp deletion beginning at Chromosome 7 position 117,548,302 bp and ending after 117,549,292 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256104 (exon 3) and 477 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 104 amino acids later. (J:188991)