Coro2b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GCCACAGTCAGCAGGCAGAT, AGAGAAGCAACGAGAGTAGA, GGACCCACACGTGCCACCTT and TGGTAGCTCTACTAGGGGCA, which resulted in a 358 bp deletion beginning at Chromosome 9 position 62,427,786 bp and ending after 62,428,143 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001375364 (exon 8) and 261 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 290 and early truncation 21 amino acids later. (J:188991)