Ralgps1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAACAGCCTTCTCCAACCA, CCCAACATAGATCTCTGTGA, GGATAGGAACACTAGTGAGG and ACTTCTATCCAGGGTTTGAT, which resulted in a 524 bp deletion beginning at Chromosome 2 position 33,260,322 bp for 139 bp then a 7 bp (GTTGTGG) endogenous retention followed by an additional 385 bp deletion ending after 33,260,852 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000603840 (exon 8) and 397 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 6 bp deletion (ACTCTC) 19 bp before the 524 bp deletion as well as a 5 bp deletion (GTGGAG) 31 bp after the 524 bp deletion, neither of which are expected to alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 161 and early truncation 6 amino acids later. (J:188991)