Ppfia1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCTCTGTGGGTATGCAA, GCAACTCTCTCACATGGACT, GCTGCTGTCTCTGCGGGCGT and GGTGATAGACAAGTTAAAAG, which resulted in a 330 bp deletion beginning at Chromosome 7 position 144,510,211 bp and ending after 144,510,540 bp (GRCm38/mm10). This deletes ENSMUSE00000873361 (exon 13) and 250 bp of flanking intronic sequence including the splice acceptor and donor. In addition, a 55 bp sequence corresponding to Chr 7:144512416-144512470, from the upstream intron between exons 11 and 12, and inserted into the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 496 and early truncation 41 amino acids later. (J:188991)