This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CATTTCCTGCTAAGGGACGA, ACAGTAGTAGCCTCTTCACA, TTGAGTTTAAAAGCTTTTGG and TTTTAACAGACAAAAGTGAA, which resulted in a 633 bp deletion beginning at Chromosome 9 position 115,280,019 bp and ending after 115,280,651 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219753 (exon 2) and 524 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. (J:188991)