Psmd6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTTGCACTGATGTACAACAT, GCTAAGATCGGCTCTCAAGC, AGCACCTCTCATCTGCAGAG and TGATCGCGACTAAGGCCAAG, which resulted in a 548 bp deletion beginning at Chromosome 14 position 14,119,831 bp and ending after 14,120,378 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120407 (exon 2) and 342 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (G) insertion at the deletion site that will not alter the results of the exon deletion and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 12 amino acids later. (J:188991)