Med12l^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GCGAAGCACACTTACAGAGG, TCTGTCTAGACAAGAGACGA, AGTGCATGCAGTTTGAAAGG and GGAACAGTTACGTGGACTGG, which resulted in a 468 bp deletion beginning at Chromosome 3 position 59,042,183 bp and ending after 59,042,650 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000173265 (exon 4) and 308 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 41 amino acids later. (J:188991)