Tesk2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCCACACACAGAACATACC and CTAGCTCAACCCCAGCAAGA, which resulted in a 319 bp deletion beginning at Chromosome 4 position 116,751,039 bp and ending after 116,751,357 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000259051 (exon 3) and 197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 27 amino acids later. (J:188991)