Tmc4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAACCAGACCTTTTCCCAA and GAGTCAGCGTCAGAAAATGA, which resulted in a 277 bp deletion beginning at Chromosome 7 position 3,675,326 bp and ending after 3,675,602 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001301550 (exon 3) and 131 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 6 amino acids later. (J:188991)