Slc39a10^em1(IMPC)J

This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences GTATGAGTACTACCTTAAAG, ATTTTTTGCATAAATTCCTA, TATTTCCTCTGGCCCTGTAG and TCTGATCCTGTATGAATCTT, which resulted in a 521 bp deletion beginning at Chromosome 1 position 46,832,525 bp and ending after 46,833,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325787 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) insertion 164 bp after the exon deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 338 and early truncation 19 amino acids later. (J:188991)