Ints7^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CAAATACTAACTTATACAGG, TTAAATCTCATATTAAAGTA, TGTCAAATACTAACTTATAC and ATTGTAGGCTTTCTTACAGA, which resulted in a 515 bp deletion beginning at Chromosome 1 position 191,582,302 bp and ending after 191,582,816 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000286639 (exon 2) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 11 amino acids later. (J:188991)