This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGGTATCACTTGTCAGACAA, CTATTGGAGGAAAGGCCAAG, AAGGTATCACTTGTCAGACA and GCACTGTGCCTAATCAAGAG, which resulted in a 1426 bp deletion beginning at Chromosome 4 position 116,088,205 bp and ending after 116,089,630 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000181518 (exon 4) and 303 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is an 11bp deletion (CTTGGCCTTTC) 128 bp before the exon deletion, and a 16 bp insertion (AAACCTAGATTTGTGC) at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 40 amino acids later. (J:188991)