This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACATGACGAAAACAGCCA, TTGTTGTCTGCTAACAGTAG, GACCTGAGATATTTATTGAG and CAGTGTATTTGTACAGTTAG, which resulted in a 498 bp deletion beginning at Chromosome 8 position 110,841,393 bp and ending after 110,841,890 bp (GRCm38/mm10). This mutation deletes the last 120 bp of ENSMUSE00000311482 (exon 4) and 378 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 7 amino acids later, probably by read through in the intron after the deletion. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count