Nup153^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GGTCAGATGCTATCACACTC and ATACCAAGATCTAGATTTAG, which resulted in a 447 bp deletion beginning at Chromosome 13 position 46,717,030 bp and ending after 46,717,476 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000456072 (exon 2) and 224 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 14 amino acids later. (J:188991)